التفاصيل البيبلوغرافية
العنوان: |
Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria |
المؤلفون: |
Raji, M.I.O., Balogun, D.O., Riskuwa, M.L, Ibrahim, A.D., Adisa-Raji, N.O. |
المصدر: |
Sokoto Journal of Medical Laboratory Science; Vol. 7 No. 4 (2022); 35-46 ; 2536-7153 |
بيانات النشر: |
School of Medical Laboratory Science, Usmanu Danfodiyo University Sokoto, Sokoto, Nigeria |
سنة النشر: |
2023 |
المجموعة: |
AJOL - African Journals Online |
مصطلحات موضوعية: |
Molecular detection, Epstein Barr virus co-infection, HIV positive women, Sokoto - Nigeria |
الوصف: |
Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is a type of herpes virus with no clinical manifestation in majority of individuals. However, when it occurs in adulthood, it causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection of EBV co-infection among HIV positive women attending some selected hospitals in Sokoto, Nigeria. Questionnaires were administered on 80 consenting HIV positive women attending three selected hospitals in Sokoto to gather data on socio-demography and risk factors. Blood samples were aseptically collected by venipuncture from the HIV positive patients and EBV screening done using PCR analysis with primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 EBV (EBV-1) and primer +5' GGTAGCCTTAGGACATACTC (Forward), -5' TGGAGGGAGTCCTGTACTAT (Reverse) for Type 2 EBV (EBV-2). Result indicated that majority (63.75%) of the HIV positive women were in the age group of 21-30 years withEBV-1 having the highest occurrences of 60.7%. Co-infection of EBV among HIV positive women attending the selected hospitals in Sokoto, Nigeria was established with EBV-1 having the highest prevalence and in subjects in polygamous relationships. |
نوع الوثيقة: |
article in journal/newspaper |
وصف الملف: |
application/pdf |
اللغة: |
English |
العلاقة: |
https://www.ajol.info/index.php/sokjmls/article/view/242296/229112Test; https://www.ajol.info/index.php/sokjmls/article/view/242296Test |
الإتاحة: |
https://www.ajol.info/index.php/sokjmls/article/view/242296Test |
رقم الانضمام: |
edsbas.DBC2E65D |
قاعدة البيانات: |
BASE |