المؤلفون: Mohammed Haruna Yeldu, Mohammed Danjuma, Mainasara Abdullahi Sulaiman, Jiya Nma Muhammad, Garba Balkisu Illah, Yakubu Ibrahim, Buhari Shehu

المصدر: Asian Journal of Medical Sciences, Vol 11, Iss 2, Pp 64-70 (2020)

مصطلحات موضوعية: vitamin d status, asthma, children, sokoto-nigeria, Medicine

الوصف: Background: Asthma is a common chronic disorder of the airways that is complex and characterized by variable and recurring symptoms. It is characterized by the occurrence of bronchial hyper responsiveness, airflow obstruction and an underlying inflammation. Several studies have proposed the association of vitamin D with increased incidence of asthma symptoms. Aims and Objectives: This study aimed at determining the serum vitamin D status and biochemical parameters among asthmatic children in Sokoto-Nigeria. Materials and Methods: The study population consisted of 120 subjects including 80 asthmatic children and 40 age-and sex-matched apparently healthy controls from two tertiary Hospitals in Sokoto Metropolis. Serum vitamin D, calcium, parathyroid hormone (PTH), immunoglobulin E (IgE) and magnesium were measured using standard techniques. Results: Mean serum vitamin D and magnesium were significantly (p ˂ 0.05) lower, while serum PTH and IgE were significantly higher (p˂0.001) in asthmatic children than in controls. Vitamin D insufficiency was found to be prevalent among the asthmatic children. There was no significant relationship between the low level of vitamin D and asthma severity. Conclusion: This study observed that, hypovitaminosis D and hypomagnesaemia occurred among asthmatic children, and asthma was more prone in the younger children than in their older counterpart. It is recommended that in order to avoid or limit the rate of children having asthmatic episodes, vitamin D and magnesium supplements should be used in the management of asthmatic children.

وصف الملف: electronic resource

العلاقة: https://www.nepjol.info/index.php/AJMS/article/view/26772Test; https://doaj.org/toc/2467-9100Test; https://doaj.org/toc/2091-0576Test

الوصول الحر: https://doaj.org/article/54afadb360434eecb1b2138aa7171baeTest

المؤلفون: Aliyu, Mansur, Bagarawa, Mukhtar U., Mu’azu, Abba N., Umar, Muhammad T.

المصدر: Caliphate Journal of Science and Technology; Vol. 5 No. 1 (2023); 22-31

مصطلحات موضوعية: Phishing, Awareness, Students, Tertiary, Institution, Sokoto, Nigeria

الوصف: The average loss by companies to phishing in 2021 is $14.8 million, more than triple what it was in 2015. That translates to hundreds of billions of dollars in total losses from phishing attacks on global businesses, and the vulnerability of these attacks is every day increasing, particularly among the younger generation less than 40 years of age. This paper begins with a background exposition on phishing trends and highlights previous findings concerning users' susceptibility to phishing attacks. It however explores the term Phishing itself, its kinds, types and some basic measures necessary for defense against phishing activities. The research was employed with a major focus on the email aspect of phishing. Alongside the website aspect of phishing, the certificate of a website was also considered. The purpose of this study was to identify the level of student awareness related to specific phishing tactics. Findings revealed that while students are unlikely to provide personal information in response to an email/SMS request, they can be easily tricked by numerous other tactics. This paper reports the findings of the study in addition to listing suggested points to employ for creating phishing awareness.

وصف الملف: application/pdf

الوصول الحر: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::8e188f3faad46cfe5598827fefa338d9Test
https://doi.org/10.4314/cajost.v5i1.4Test

المؤلفون: Raji, M.I.O., Balogun, D.O., Riskuwa, M.L, Ibrahim, A.D., Adisa-Raji, N.O.

المصدر: Sokoto Journal of Medical Laboratory Science; Vol. 7 No. 4 (2022); 35-46 ; 2536-7153

مصطلحات موضوعية: Molecular detection, Epstein Barr virus co-infection, HIV positive women, Sokoto - Nigeria

الوصف: Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is a type of herpes virus with no clinical manifestation in majority of individuals. However, when it occurs in adulthood, it causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection of EBV co-infection among HIV positive women attending some selected hospitals in Sokoto, Nigeria. Questionnaires were administered on 80 consenting HIV positive women attending three selected hospitals in Sokoto to gather data on socio-demography and risk factors. Blood samples were aseptically collected by venipuncture from the HIV positive patients and EBV screening done using PCR analysis with primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 EBV (EBV-1) and primer +5' GGTAGCCTTAGGACATACTC (Forward), -5' TGGAGGGAGTCCTGTACTAT (Reverse) for Type 2 EBV (EBV-2). Result indicated that majority (63.75%) of the HIV positive women were in the age group of 21-30 years withEBV-1 having the highest occurrences of 60.7%. Co-infection of EBV among HIV positive women attending the selected hospitals in Sokoto, Nigeria was established with EBV-1 having the highest prevalence and in subjects in polygamous relationships.

وصف الملف: application/pdf

العلاقة: https://www.ajol.info/index.php/sokjmls/article/view/242296/229112Test; https://www.ajol.info/index.php/sokjmls/article/view/242296Test

الإتاحة: https://www.ajol.info/index.php/sokjmls/article/view/242296Test

المؤلفون: Ahmed, A.Y., Gamde , S.M., Abubakar , S.D., Muhammad , Y., Saeed, S.A., Rimi , M.I., Umar, M., Aiyelabegan, F.

المصدر: Bayero Journal of Medical Laboratory Science; Vol. 5 No. 2 (2020); 147-151

مصطلحات موضوعية: HIV-infected Males, Hypogonadisms, Sokoto Nigeria

الوصف: Background: This study aimed to evaluate the Serum Androgenic Profiles of HIV-infected Male Patients on Highly Active Antiretroviral Therapy and those not on Active Antiretroviral Therapy in Specialist Hospital Sokoto, Nigeria. Materials and Methods: One hundred and thirty-five HIV-infected male patients were evaluated in the Department of Medicine, Specialist Hospital Sokoto Nigeria from July 2017 to March 2018 using history, baseline investigations, and CD4counts. Free testosterone, luteinizing hormone (LH), and follicle-stimulating hormone (FSH) were measured using an overnight fasting serum sample. Patients were divided into three groups (n=45); Group A= HIV-infected male patients on HAART, Group B = HIV-infected male treatment naive patients, and Group C= HIV-negative control subjects. Data were analysed using ANOVA and Chi-square tests and p≤ 0.05 was considered statistically significant Results: The serum testosterone and CD4 counts were reduced in HIV-infected male patients on HAART and HAART naive compared to the negative control. The reduced testicular functions were substantiated by raised serum LH and FSH in HIV-infected male patients on HAART (p < 0.05) compared to the negative control. Conclusions: HIV-infections associated with low CD4 counts even among patients on Highly Active Antiretroviral Therapy may pose threat to male fertility. Keywords: HIV-infected Males; Hypogonadisms; Sokoto Nigeria

وصف الملف: application/pdf

الوصول الحر: https://explore.openaire.eu/search/publication?articleId=78975075580c::ea83bf19c0f4845f68132158be28bed9Test
https://www.ajol.info/index.php/bjmls/article/view/230414Test

المؤلفون: Usman M. Aliyu, Abdulgafar O. Jimoh, Abdulmajeed Yunusa, Moh’d Umar

المصدر: Journal of Clinical and Diagnostic Research, Vol 9, Iss 8, Pp XC01-XC04 (2015)

مصطلحات موضوعية: late presentation, oncology, sokoto nigeria, Medicine

الوصف: Background: Cancer is a leading public health problem worldwide. In many developing countries, cancer tends to present in predominantly advanced stages, to a certain extent due to lack of comprehensive screening and poor access to efficient management. This study was carried out to describe the pattern of cancers managed in the Department of Radiotherapy and Oncology in Usmanu Danfodiyo University Teaching Hospital Sokoto, North-western Nigeria. Materials and Methods: This was a cross-sectional descriptive study involving patients with malignancies that attended the new Oncology Department of the Usman Danfodiyo University Teaching Hospital Sokoto, North-West Nigeria for the period of one year (June 2013 – May 2014). The data was analyzed using SPSS (versions 20). Result: A total of 210 patients with complete records met the criteria for the study. Majority 162 (77.1%) were females with a mean age of 45.68±12.4 years. The male patients were 48 (22.9%) with mean age 46.27±16.5. The spectrum of malignant lesions observed were cancer of the cervix 77 (36.67%), breast cancer 74 (35.24%), nasopharyngeal cancer 20 (9.52%), cancer of the larynx 18 (8.57%) and rectal cancer 14 (6.67%). Late presentation was most common with 6 (3%), 101 (49.8%) and 58 (28.6%) patients presenting at stage I, III and IV, respectively. Conclusion: The study demonstrates that Cancer of the cervix is the leading malignancy in the study population.

وصف الملف: electronic resource

العلاقة: https://jcdr.net/articles/PDF/6379/13892_CETest(RA1)_F(T)_PF1(PAK)_PFA(AK)_PF2(PAG).pdf; https://doaj.org/toc/2249-782XTest; https://doaj.org/toc/0973-709XTest

الوصول الحر: https://doaj.org/article/a5b2e61a8ab042ee9b371757f70f025bTest

المؤلفون: Jiya Nma Muhammad, Yakubu Ibrahim, Mainasara Abdullahi Sulaiman, Mohammed Danjuma, Mohammed Haruna Yeldu, Buhari Shehu, Garba Balkisu Illah

المصدر: Asian Journal of Medical Sciences, Vol 11, Iss 2, Pp 64-70 (2020)

مصطلحات موضوعية: Asthmatic children, Serum vitamin, sokoto-nigeria, children, business.industry, lcsh:R, vitamin d status, lcsh:Medicine, Medicine, Physiology, asthma, General Agricultural and Biological Sciences, business

الوصف: Background: Asthma is a common chronic disorder of the airways that is complex and characterized by variable and recurring symptoms. It is characterized by the occurrence of bronchial hyper responsiveness, airflow obstruction and an underlying inflammation. Several studies have proposed the association of vitamin D with increased incidence of asthma symptoms. Aims and Objectives: This study aimed at determining the serum vitamin D status and biochemical parameters among asthmatic children in Sokoto-Nigeria. Materials and Methods: The study population consisted of 120 subjects including 80 asthmatic children and 40 age-and sex-matched apparently healthy controls from two tertiary Hospitals in Sokoto Metropolis. Serum vitamin D, calcium, parathyroid hormone (PTH), immunoglobulin E (IgE) and magnesium were measured using standard techniques. Results: Mean serum vitamin D and magnesium were significantly (p ˂ 0.05) lower, while serum PTH and IgE were significantly higher (p˂0.001) in asthmatic children than in controls. Vitamin D insufficiency was found to be prevalent among the asthmatic children. There was no significant relationship between the low level of vitamin D and asthma severity. Conclusion: This study observed that, hypovitaminosis D and hypomagnesaemia occurred among asthmatic children, and asthma was more prone in the younger children than in their older counterpart. It is recommended that in order to avoid or limit the rate of children having asthmatic episodes, vitamin D and magnesium supplements should be used in the management of asthmatic children.

الوصول الحر: https://explore.openaire.eu/search/publication?articleId=doi_dedup___::e7a958178ca095fd43ef3dd267034a12Test
https://doi.org/10.3126/ajms.v11i2.26772Test

العنوان البديل: Normal Beyin Gelişimi Gösteren Çocuklarda Bilgisayarlı Tomografi (BT) Taraması İle Kranial İndeksin Belirlenmesi: Retrospektif Bir Çalışma. (English)

المؤلفون: Musa, Muhammad Awwal, Danfulani, Muhammad

المصدر: Cukurova Medical Journal / Çukurova Üniversitesi Tip Fakültesi Dergisi; 2015, Vol. 40 Issue 2, p239-244, 6p

مصطلحات موضوعية: SKULL growth, COMPUTED tomography, NEURAL development, USMANU Danfodiyo University (Sokoto, Nigeria), HYPERBRACHYCEPHALY, BRACHYCEPHALY, CHILDREN'S health

الملخص (بالإنجليزية): Purpose: Cranial Index (CI) determination is of clinical significance in the evaluation of skull growth and development in children. This study investigated cranial index in computed tomography (CT) scans of children seen in the Radiology Department of Usmanu Danfodiyo University Teaching Hospital Sokoto, Nigeria. Materials and Methods: A total of CT scan records of 76 children (42 males and 34 females) with normal brain development were used for this retrospective study. The cranial length (CL) and cranial width (CW) were measured on the axial CT and cranial index calculated as the percentage of cranial width to cranial length multiplied by 100. Mean values of CL, CW, CI as well as standard deviations and standard error of mean were calculated for both sexes. Results: The overall mean values for cranial length was 16.45±1.01, cranial width 13.01±0.94 and CI was 79.12±3.37. Meanwhile in males, the CI was 78.35±3.23 and 80.08±3.34 in females respectively. Thus, classifying head patterns based on the CI values seen in this study, 55.26% of the children had mesocephalic head shape and 28.95% had brachycephaly. Dolicocephaly and hyperbrachycephaly had a frequency of 7.89% each. Conclusion: Cranial Index (CI) reported in this study showed that most of the children had mesocephalic head shape (55.26%) with dolicocephaly (7.89%) and brachycephaly (7.89%) less common. The observed difference between the mean cranial index of males and females was statistically significant (p = 0.025). The report from this study is of importance in the field of pediatric neurology, anthropology as well as genetics and forensic medicine. [ABSTRACT FROM AUTHOR]

Abstract (Turkish): Amaç: Kranial endeksin belirlenmesi çocuklarda kafatasý büyümesi ve geliþiminin belirlenmesinde klinik bir öneme sahiptir. Bu çalýþmada Nijerya'da Usmanu Danfodiyo üniversitesi Sokoto araþtýrma hastanesi radyoloji bölümüne baþvuran çocuklarýn bilgisayarlý tomografi (BT) taramasý ile kranial endeksleri belirlenmiþtir. Materyal ve Metod: Normal beyin geliþimine sahip 76 çocuðun (42 erkek ve 34 kýz) BT taramasý bu retrospektif çalýþma için kullanýlmýþtýr. Kranial uzunluk ve kraniyal geniþlik aksiyal BT'de ölçülmüþ, kraniyal indeks, kraniyal geniþliðin kraniyal uzunluða oranýnýn 100 ile çarpýlmasý ile hesaplanmýþtýr. Kranial uzunluk, kraniyal geniþlik, kranial indeks'in ortalama deðerleri ve ortalamanýn standart sapma ve standart hata deðerleri her iki cinsiyet için hesaplanmýþtýr. Bulgular: Kranial uzunluk için ortalama deðer 16.45±1.01, kranial geniþlik için ortalama deðer 13.01±0.94 ve kranial indeks için ortalama deðer 79.12±3.37 olarak bulunmuþtur. Kranial indeks erkeklerde 78.35±3.23, kýzlarda 80.08±3.34 olarak saptanmýþtýr. Böylece bu çalýþmada kranial indeks deðerlerine göre kafa modellerini sýnýflandýrýlmýþtýr, çocuklarýn %55.26'sı mesosefalik kafa, %28.95'i ise brakisefaliye sahiptir. Dolikosefali ve hiperbrakisefalinin her birinin frekansı %7.89'dur. Sonuç: Bu çalışmada rapor edilen kranial indekse göre çocukların büyük kısmı mesosefalik kafa şekline (%55.26), daha az yaygın olarak da Dolikosefali (%7.89) ve hiperbrakisefaliye (%7.89) sahiptir. Erkek ve kızlarda ortalama kranial indeks değerleri arasında gözlenen farklılık istatistiki olarak anlamlıdır (p=0.025). Bu çalışmanın sonucu, pediatrik nöroloji, antropoloji aynı zamanda genetik ve adli tıp bakımından önem taşımaktadır. [ABSTRACT FROM AUTHOR]

: Copyright of Cukurova Medical Journal / Çukurova Üniversitesi Tip Fakültesi Dergisi is the property of Cukurova University, Faculty of Medicine and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Aliyu, Shinkafi Sa'adatu, Gambo, Aliyu

المصدر: Aceh International Journal of Science & Technology; Aug2014, Vol. 3 Issue 2, p67-72, 6p

مصطلحات موضوعية: FUNGAL spores, USMANU Danfodiyo University (Sokoto, Nigeria), INDOOR air quality, DEXTROSE

مستخلص: Indoor air contains a complex mixture of microorganisms, microorganism fragments, and by products such as molds, bacteria, endotoxins, mycotoxins, and volatile microbial organic compounds. Airborne fungi and bacteria can be toxic, allergenic and/or infectious. A research was conducted to determine the number and types of airborne fungal spores in Buildings of Usmanu Danfodiyo University Sokoto, Nigeria. Five (5) areas were chosen within the University for the Survey, these were student Hostel, Staff Quarters, Botanical garden, Microbiology laboratory and city campus of Usmanu Danfodiyo University. . A total number of fifteen (15) petri dishes containing potato dextrose agar each were vertically placed in each sampler and exposed at end of each height and site for 10 and 20 minutes respectively. A total of thirteen (13) different fungal specie were identified namely; Aspergillus niger, A. flavus, A fumigates, A. ustus, A. terreus, Fusarium solani, F. oxysporum, Alterneria altenata, Rhizopus oryzae, R. stolonifer, Helminthosporum sp., Penicillum candidum and Absedia corymbifera. Aspergillus niger had the highest frequency of occurrence of (14.9%), Helminthosporus species had the least frequency of occurrence of (1.5%). Conclusively it was observed that the concentration of fungal spores was high in the upper surface than the ground level at the time of the survey. [ABSTRACT FROM AUTHOR]

: Copyright of Aceh International Journal of Science & Technology is the property of PPs-Unsyiah and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Jamila A. Garba, Sadiq Umar

المصدر: African Journal of Primary Health Care & Family Medicine, Vol 5, Iss 1, Pp e1-e6 (2013)

مصطلحات موضوعية: Maternal Mortality, Verbal Autopsy, Sokoto, Nigeria, Medicine, Public aspects of medicine, RA1-1270

الوصف: Background: Maternal mortality in developing countries is higher than that in developed countries. There are few published articles on the factors associated with maternal deaths in northern Nigeria. Objectives: The objective of this study was to identify the medical causes and factors associated with maternal mortality in Sokoto, northern Nigeria. Method: A verbal autopsy questionnaire was used to interview close relatives of women within the reproductive age group who had died of pregnancy-related complications in theSokoto metropolis during the preceding two years. A multistage sampling method using simple random sampling at each step was used to select areas of study within the Sokoto metropolis. Data analysis was carried out using a statistical package for social sciences (SPSS),version 19, and the Spearman correlation was used to test association. Significance level was set at 0.05. Results: The major causes of death were haemorrhage (48.3%), eclampsia (19%) and prolonged labour (13.8%). The association between maternal mortality and the absence of antenatal booking was significant (p < 0.001); the association between maternal mortality andthe ‘three delays’ was also significant (p = 0.013). The association between maternal mortality and educational status and occupation was, however, not significant (p = 0.687 and p = 0.427respectively). Conclusion: The medical causes of maternal mortality identified in this study were similar to those of the hospital-based studies in the area. In addition, an association between maternal deaths and the ‘three delays’ and the absence of antenatal booking was found. There is a need for public education efforts to address these factors in order to reduce maternal mortality in the study area.

وصف الملف: electronic resource

العلاقة: https://phcfm.org/index.php/phcfm/article/view/442Test; https://doaj.org/toc/2071-2928Test; https://doaj.org/toc/2071-2936Test

الوصول الحر: https://doaj.org/article/b6782537cbfc495c9d92cc866cace35dTest

المؤلفون: Bunza, F. U., Mainasara, A. S., Dallatu, M. K., Bunza, J. M., Wasagu, I. Z.

المصدر: Bayero Journal of Pure & Applied Sciences; Jun2014, Vol. 7 Issue 1, p1-5, 5p

مصطلحات موضوعية: DIABETIC nephropathies, DISEASE prevalence, ALBUMINURIA, DIAGNOSIS of diabetes, BLACK Africans, USMANU Danfodiyo University (Sokoto, Nigeria), DISEASE risk factors

مستخلص: Diabetic nephropathy is a common phenomenon in patients with diabetes. Its prevalence risk factors have not been fully described in black African patients. This study determined the prevalence of microalbuminuria (mal) among diabetic patients in Usmanu Danfodiyo University Teaching Hospital (UDUTH) Sokoto. It involved 100 diabetics and 50 healthy controls. Mal was estimated by BCG-dye binding method, while fasting blood glucose (FBG) by glucose oxidation method. The prevalence of mal varied between males (24.3%) and females (16.6%). The duration of the disease ranged from < 5 years (42.0%) with 8(14.5%) having abnormal mal, (58%) >5 years with (31%) having abnormal mal, (30%) < 30 years having (17.1%) having abnormal mal and (70%) >30 years having (24%) with abnormal mal. The prevalence of mal was 22% (17% males and 5% females). FBG differed significantly (p<0.05) between patients (11.01±1.03 mmol/l) and control subjects (4.38±0.07 mmol/l). Urinary albumin excretion was significantly higher in diabetics than in control (57.65±18.92 versus 24.16±1.48 mg/24 hrs respectively). Mal significantly (p<0.05) increased with duration of diagnosis of diabetes (108.6±14 versus 214.6±9.1 mg/24hrs in <5 years and >5years group respectively). Poor glycaemic control was the only modifiable predictor for the development of mal. Other non-modifiable risk factors related to progression of mal are sex and duration of disease. Early diagnosis of mal and aggressive glycaemic control is hereby recommended. [ABSTRACT FROM AUTHOR]

: Copyright of Bayero Journal of Pure & Applied Sciences is the property of Bayero Journal of Pure & Applied Sciences and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)