المؤلفون: Moosavy, Mir-Hassan, de la Guardia, Miguel, Mokhtarzadeh, Ahad, Khatibi, Seyed Amin, Hosseinzadeh, Neda, Hajipour, Nasser

المصدر: Scientific Reports; 5/4/2023, Vol. 13 Issue 1, p1-15, 15p

مصطلحات موضوعية: SPEARMINT, SILVER nanoparticles, ESSENTIAL oils, GOLD nanoparticles, BIOACTIVE compounds, TRANSMISSION electron microscopy, ULTRAVIOLET-visible spectroscopy, MASS spectrometers

مستخلص: Green synthesis of bioactive nanoparticles (NPs) is getting more attractive in various fields of science including the food industry. This study investigates the green synthesizing and characterization of gold NPs (AuNPs) and silver NPs (AgNPs) produced using Mentha spicata L. (M. spicata) essential oil as well as their antibacterial, antioxidant, and in vitro cytotoxic effects. The essential oil was mixed with both Chloroauric acid (HAuCl4) and aqueous silver nitrate (AgNO3) solutions separately and incubated at room temperature for 24 h. The chemical composition of the essential oil was identified by gas chromatography coupled with a mass spectrometer detector (GC–MS). Au and Ag nanoparticles were characterized using UV–Vis spectroscopy, transmission electron microscopy, scanning electron microscopy, dynamic light scattering (DLS), X-ray diffraction (XRD) and Fourier transform infrared (FTIR). The cytotoxicity of both types of nanoparticles was evaluated using MTT assay on cancerous HEPG-2cell line by exposing them to various concentrations of both NPs for 24 h. The antimicrobial effect was evaluated by the well-diffusion technique. The antioxidant effect was determined by DPPH and ABTS tests. According to the results of GC–MS analysis, 18 components were identified, including carvone (78.76%) and limonene (11.50%). UV–visible spectroscopy showed a strong absorption peak of 563 nm and 485 nm, indicating the formation of Au NPs and Ag NPs, respectively. TEM and DLS demonstrated that AuNPs and AgNPs were predominantly spherical shaped with average sizes of 19.61 nm and 24 nm, respectively. FTIR analysis showed that biologically active compounds such as monoterpenes could assist in the formation and stabilization of both types of NPs. Additionally, XRD provided more accurate results, revealing a nano-metal structure. Silver nanoparticles exhibited better antimicrobial activity against the bacteria than AuNPs. Zones of inhibition ranging 9.0–16.0 mm were recorded for the AgNPs, while zones of 8.0–10.33 mm were observed AuNPs. In the ABTS assay, the AuNPs and AgNPs showed a dose-dependent activity and synthesized nanoparticles exhibited higher antioxidant activity than MSEO in both assays. Mentha spicata essential oil can be successfully used for the green production of Au NPs and Ag NPs. Both green synthesized NPs show antibacterial, antioxidant, and in vitro cytotoxic activity. [ABSTRACT FROM AUTHOR]

: Copyright of Scientific Reports is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Shahbazi-Derakhshi, Payam, Mahmoudi, Elham, Majidi, Mir Mostafa, Sohrabi, Hessamaddin, Amini, Mohammad, Majidi, Mir Reza, Niaei, Aligholi, Shaykh-Baygloo, Nima, Mokhtarzadeh, Ahad

المصدر: Biosensors (2079-6374); Feb2023, Vol. 13 Issue 2, p172, 21p

مصطلحات موضوعية: STOMACH cancer, GOLD nanoparticles, CANCER cells, MICRORNA, GRAPHENE oxide

مستخلص: In the present research work, the state-of-art label-free electrochemical genosensing platform was developed based on the hybridization process in the presence of [Fe(CN)6]^3−/4− as an efficient redox probe for sensitive recognition of the miRNA-21 in human gastric cell lines samples. To attain this aim, perovskite nanosheets were initially synthesized. Afterward, the obtained compound was combined with the graphene oxide resulting in an effective electrochemical modifier, which was dropped on the surface of the Au electrode. Then, AuNPs (Gold Nano Particles) have been electrochemically-immobilized on perovskite-graphene oxide/Au-modified electrode surface through the chronoamperometry (CA) technique. Finally, a self-assembling monolayer reaction of ss-capture RNA ensued by the thiol group at the end of the probe with AuNPs on the modified electrode surface. miRNA-21 has been cast on the Au electrode surface to apply the hybridization process. To find out the effectiveness of the synthesized modifier agent, the electrochemical behavior of the modified electrode has been analyzed through DPV (differential pulse voltammetry) and CV (cyclic voltammetry) techniques. The prepared biomarker-detection bioassay offers high sensitivity and specificity, good performance, and appropriate precision and accuracy for the highly-sensitive determination of miRNA-21. Different characterization methods have been used, such as XRD, Raman, EDS, and FE-SEM, for morphological characterization and investigation of particle size. Based on optimal conditions, the limit of detection and quantification have been acquired at 2.94 fM and 8.75 fM, respectively. Furthermore, it was possible to achieve a wide linear range which is between 10⁻¹⁴ and 10⁻⁷ for miRNA-21. Moreover, the selectivity of the proposed biosensing assay was investigated through its potential in the detection of one, two, and three-base mismatched sequences. Moreover, it was possible to investigate the repeatability and reproducibility of the related bio-assay. To evaluate the hybridization process, it is important that the planned biomarker detection bio-assay could be directly re-used and re-generated. [ABSTRACT FROM AUTHOR]

: Copyright of Biosensors (2079-6374) is the property of MDPI and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Sohrabi, Hessamaddin, Majidi, Mir Reza, Nami, Fatemeh, Asadpour-Zeynali, Karim, Khataee, Alireza, Mokhtarzadeh, Ahad

المصدر: Microchimica Acta; Mar2021, Vol. 188 Issue 3, p1-16, 16p

مصطلحات موضوعية: HAEMOPHILUS influenzae, GOLD nanoparticles, SALMONELLA typhimurium, SHIGELLA flexneri, GENES

مستخلص: An innovative label-free DNA genosensing assay based on a direct hybridization followed by DPASV in the presence of [Fe(CN)6]^4−/3− was developed for recognizing the H. influenza genome in human plasma samples. To attain this objective, Zn-based MOF was synthesized and combined with carboxymethyl cellulose (CMC), which were immobilized on the surface of Au electrode and AuNPs were immobilized on the Zn-based MOF/CMC/Au-modified electrode surface. The genosensing bio-assay provides high specificity, sensitivity, and good performance for the determination of L-fuculokinase gene from the Haemophilus influenza genome. Various characterization techniques were applied including Fe-SEM, EDS, FT-IR, and XRD for investigation of morphological features and particle size. Under optimal conditions LOD and LOQ were 1.48 fM and 3.23 fM, respectively. Moreover, a wide linear range was obtained ranging from 0.1 pM–10 nM for t-DNA. The recoveries and RSDs were 98.4–103% and 2.2–3.2, respectively. The fabricated biosensing assay presented high selective ability of one, two, and three-base mismatched sequences. In addition, negative control of the genosensing assay for investigation of the selectivity was performed by the t-DNAs of Salmonella typhimurium and Shigella flexneri bacteria. Likewise, reproducibility and repeatability of the related bio-assay were investigated. It is to be noted that the organized genosensing bio-assay can be straightforwardly reused and regenerated to assess the hybridization process. [ABSTRACT FROM AUTHOR]

: Copyright of Microchimica Acta is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Mobed, Ahmad, Mehri, Parina, Hasanzadeh, Mohammad, Mokhtarzadeh, Ahad

المصدر: Journal of Molecular Recognition; Jul2020, Vol. 33 Issue 7, p1-8, 8p

مصطلحات موضوعية: POLYETHYLENE glycol, GOLD nanoparticles, VISCERAL leishmaniasis, LEISHMANIA, DETECTION limit

مستخلص: The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmaniaspp. Despite several routine and old method for sensitive and specificity detection of Leishmaniaspp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmaniaspp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH2]6 ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10−6 to 10−21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors. [ABSTRACT FROM AUTHOR]

: Copyright of Journal of Molecular Recognition is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Farshchi, Fatemeh, Hasanzadeh, Mohammad, Mokhtarzadeh, Ahad

المصدر: Journal of Molecular Recognition; Apr2020, Vol. 33 Issue 4, p1-9, 9p

مصطلحات موضوعية: TRACE elements, IRON oxide nanoparticles, CARBON electrodes, GOLD nanoparticles, CYSTEAMINE

مستخلص: In this study, a novel electroconductive interface was prepared based on Fe3O4 magnetic nanoparticle and cysteamine functionalized gold nanoparticle. The engineered interface was used as signal amplification substrate in the electrochemical analysis of antibody‐antigen binding. For this purpose, biotinilated‐anti‐prostate‐specific antigen (PSA) antibody was bioconjugated with iron oxide magnetic nanoparticles (Fe3O4) and drop‐casted on the surface of glassy carbon electrode (GCE). Also, secondary antibody (HRP‐Ab2) encapsulated on gold nanoparticles caped by cysteamine was immobilized on the surface of GCE modified electrode. A transmission electron microscopy images shows that a sandwich immunoreaction was done and binding of Ab1 and Ab2 performed successfully. Various parameters of immunoassay, including the loading of magnetic nanoparticles, the amount of gold nanoparticle conjugate, and the immunoreaction time, were optimized. The detection limit of 0.001 μg. L−1 of PSA was obtained under optimum experimental conditions. It is found that such magneto‐bioassay could be readily used for simultaneous parallel detection of multiple proteins by using multiple inorganic metal nanoparticle tracers and are expected to open new opportunities for early stage diagnosis of cancer in near future. [ABSTRACT FROM AUTHOR]

: Copyright of Journal of Molecular Recognition is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Mokhtarzadeh, Ahad^1,2 (AUTHOR), Vahidnezhad, Hassan³ (AUTHOR), Youssefian, Leila^3,4 (AUTHOR), Mosafer, Jafar⁵ (AUTHOR), Baradaran, Behzad¹ (AUTHOR) Behzad_im@yahoo.com, Uitto, Jouni^1,3 (AUTHOR) Jouni.Uitto@jefferson.edu

المصدر: Trends in Molecular Medicine. Dec2019, Vol. 25 Issue 12, p1066-1079. 14p.

مصطلحات موضوعية: *NANOMEDICINE, *TREATMENT effectiveness, *DNA folding, *DNA nanotechnology, *TARGETED drug delivery, *GENE therapy, *CATIONIC lipids

مستخلص: Spherical nucleic acids (SNAs) are nanostructures consisting of highly oriented, dense layers of oligonucleotides arranged in a spherical 3D geometry. Owing to their unique properties and function, SNAs occupy a material space distinct from 'DNA nanotechnology' and DNA origami. Over the past two decades SNAs have revolutionized gene regulation, drug delivery, gene therapy, and molecular diagnostics, and show promise for both antisense and RNAi therapy. We focus here on recent advances in the synthesis and application of SNAs in gene and drug delivery, diagnostics, and immunomodulation, as well as on the utility of nanoflares as intracellular mRNA detection systems. Nanotechnology provides new approaches for cancer therapy via the delivery of anticancer drugs using nanoparticles (NPs), by more sensitive diagnosis of cancer biomarkers and cancer cells, and by monitoring therapeutic efficacy and tumor burden over time. The recent evolution of NP synthesis and functionalization allows targeted delivery of anticancer drugs to tumor sites with minimal cellular damage or side effects on healthy tissues and organs. SNAs are an emerging class of intracellular delivery systems for the delivery of bioactive molecules, such as drugs and antisense-based therapeutics, and they are efficient for monitoring mRNA levels in living cells. [ABSTRACT FROM AUTHOR]

المؤلفون: Chenab, Karim Khanmohammadi, Eivazzadeh-Keihan, Reza, Maleki, Ali, Pashazadeh-Panahi, Paria, Hamblin, Michael R, Mokhtarzadeh, Ahad

المصدر: Nanomedicine: Nanotechnology, Biology & Medicine; Apr2019, Vol. 17, p342-358, 17p

مصطلحات موضوعية: NUCLEIC acids, SINGLE-stranded DNA, GOLD nanoparticles, OLIGONUCLEOTIDES, FLUORESCENCE, NUCLEIC acid hybridization

مستخلص: Nanoflares are intracellular probes consisting of oligonucleotides immobilized on various nanoparticles that can recognize intracellular nucleic acids or other analytes, thus releasing a fluorescent reporter dye. Single-stranded DNA (ssDNA) complementary to mRNA for a target gene is constructed containing a 3′-thiol for binding to gold nanoparticles. The ssDNA "recognition sequence" is prehybridized to a shorter DNA complement containing a fluorescent dye that is quenched. The functionalized gold nanoparticles are easily taken up into cells. When the ssDNA recognizes its complementary target, the fluorescent dye is released inside the cells. Different intracellular targets can be detected by nanoflares, such as mRNAs coding for genes over-expressed in cancer (epithelial-mesenchymal transition, oncogenes, thymidine kinase, telomerase, etc.), intracellular levels of ATP, pH values and inorganic ions can also be measured. Advantages include high transfection efficiency, enzymatic stability, good optical properties, biocompatibility, high selectivity and specificity. Multiplexed assays and FRET-based systems have been designed. Biomedical applications of nanoflares in biosensing. Nanoflares consist of oligonucleotides attached to gold nanoparticles that can release a fluorescent dye upon binding to their target. The dye excitation is wavelength matched to the plasmon resonance frequency of the nanoparticles. They are able to detect intracellular analytes such as mRNAs and ATP with high sensitivity, and can also respond to pH and metallic ions. Unlabelled Image [ABSTRACT FROM AUTHOR]

: Copyright of Nanomedicine: Nanotechnology, Biology & Medicine is the property of Elsevier B.V. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

المؤلفون: Hasanzadeh, Mohammad¹ haasanzadehm@tbzmed.ac.ir, Babaie, Parinaz¹, Mokhtarzadeh, Ahad¹, Hajizadeh, Nader¹, Mahboob, Soltanali¹

المصدر: International Journal of Biological Macromolecules. Dec2018:Part A, Vol. 120, p422-430. 9p.

مصطلحات موضوعية: *BIOLOGICAL assay, *BRUCELLA, *GOLD nanoparticles, *DETECTION of microorganisms, *HISTIDINE

مستخلص: Abstract Brucella organisms, which are small aerobic intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. In this work, we used a novel method to preparation of excellent genosensor on the surface of low-toxic substrate (gold nanoparticles) supported histidine prepared by fully electrodeposition method. The results of the present work show that the nano-Au-Hist provide suitable active sites for the DNA probe immobilization. The fabricated DNA genosensor employs cyclic voltammetry (CV), and square wave voltammetry (SWV) techniques for monitoring the behavior of the redox probe. To survey the morphological pattern and surface structural characterizations, the Field Emission-Scanning Electron Microscopy (FE-SEM) has been applied. In summary, the gold nanoparticles supported by histidine was checked for immobilization of a Brucella -specific probe and detection of hybridization with a variety of sequences with a high sensitivity. The high sensitivity would be related to more favorable conformation and deflection angle of the probe for an efficient hybridization, higher surface concentration of the probe, and/or enhanced diffusion regime. These lead to better display of the entangled target sequences arising from the nanobiotechnology. The proposed genosensor showed a perfect distinction between complementary, non-complementary and mismatched DNA sequences. The engineered genosensor for detection of the complementary/non-complementary sequences were assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples with and without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence in linear concentration range of 1 × 10−1 to 1 × 10−10 μM, and a low limit of quantification 0.1 pM. [ABSTRACT FROM AUTHOR]

المؤلفون: Hasanzadeh, Mohammad¹ mhmmd_hasanzadeh@yahoo.com, Baghban, Hossein Navay², Mokhtarzadeh, Ahad³, Shadjou, Nasrin^4,5, Mahboob, Soltanali⁶

المصدر: International Journal of Biological Macromolecules. Dec2017 Part 1, Vol. 105, p1337-1348. 12p.

مصطلحات موضوعية: *TUMOR suppressor proteins, *GOLD nanoparticles, *BIOTIN derivatives, *CYSTEINE derivatives, *SCANNING electron microscopes

مستخلص: An innovative mediator-free electrochemical immunosensor for quantitation of p53 tumor suppressor protein based on signal amplification strategy was fabricated. In this work, biotin conjugated p53-antibody (anti-p53) was immobilized onto a green and biocompatible nanocomposite containing poly l -cysteine (P-Cys) as conductive matrix and 3D gold nanoparticles (GNPs) as signal amplification element. Therefore, a novel nanocomposite film based on P-Cys and GNPs was exploited to develop a highly sensitive immunosensor for detection of p53 protein. Importantly, GNPs prepared by sonoelectrodeposition method which lead to compact morphology. Fully electrochemical methodology was used to prepare a new transducer on a gold surface which provided a high surface area to immobilize a high amount of the anti-p53. The surface morphology of electrode was characterized by high-resolution field emission scanning electron microscope (FE-SEM) and energy dispersive spectroscopy (EDX). The immunosensor was employed for the detection of p53 in physiological pH using square wav voltammetry and differential pulse voltammetry (DPVs) techniques. Under optimized condition the calibration curve for p53 concentration by SWV and DPV was linear in 0.0369–50 pM and 0.018–2.5 pM with lower limit of quantification of 48 fM and 18 fM, respectively. The method was successfully applied assay of the p53 in unprocessed human plasma samples. Also, the method was applied to the assay of p53 in human plasma sample and normal and malignant cell line lysates such as (L929 normal cell Line from mouse C3H (L929), colon cancer cell-HCT, prostate cancer cell line PC-3, and human breast adenocarcinoma cell line-MCF7). [ABSTRACT FROM AUTHOR]

المؤلفون: Hasanzadeh, Mohammad¹ hasanzadehm@tbzmed.ac.irmhmmd_hasanzadeh@yahoo.com, Solhi, Elham¹, Jafari, Mohsen¹, Mokhtarzadeh, Ahad¹, Soleymani, Jafar¹, Jouyban, Abolghasem¹, Mahboob, Soltanali¹

المصدر: International Journal of Biological Macromolecules. Dec2018:Part B, Vol. 120, p2493-2508. 16p.

مصطلحات موضوعية: *CARBON electrodes, *HORSERADISH peroxidase, *GOLD nanoparticles, *TUMOR proteins, *IMMUNOASSAY

مستخلص: Abstract Breast cancer is the most common threat in women worldwide. Increasing death rate of diagnosed cases is the main leading cause of designing specific immunoassay for tumor marker in breast cancer. Cancer antigen 15-3 (CA 15-3) is a tumor protein for many types of cancer, most notably breast cancer. Herein, we report a sandwich-type electrochemical immunosensor based on signal amplification strategy of multiple nanocomposites to detection of CA 15-3 biomarker. The proposed immunosensor fabricated by reduced graphene oxide (rGO), poly-dopamine (PDA) and amino functionalized mesoporous silica (MCM-41-NH 2) doped by gold nanoparticles composite on the glassy carbon electrode with a large surface area which was prepared a new platform to immobilization of primary antibodies and provide excellent conductivity. To further amplify the electrochemical signal, the trace tag on the foundation of gold nanoparticles (AuNPs) is coated with MCM-41-NH 2 nanocomposite through thionine linking, which provides more amino groups to capture more horseradish peroxidase-labeled antibodies (HPR-Ab2) and enhances the conductivity. Under optimal conditions, the developed immunosensor exhibits excellent analytical performance for the determination of CA 15-3 with a wide linear range from 0.002 to 125 U/mL and a low limit of quantification of 0.002 U/mL. Furthermore, satisfactory results are obtained for the determination of CA 15-3 in human plasma samples, indicating the potential of the immunoassay to be applied in clinical analysis. [ABSTRACT FROM AUTHOR]